Introduction Case Study - Genome Assembly#
What is Genome Assembly?#
Genome assembly is the process of using sequencing methods to generate sequence fragments (called reads) from the genome of the species to be studied. These fragments are then assembled based on overlapping regions between the reads. Initially, the fragments are joined into longer contiguous sequences (contigs), and then contigs are assembled into even longer scaffolds that may include gaps. By resolving errors and gaps in the scaffolds, we can map these scaffolds to chromosomes, ultimately producing a high-quality whole genome sequence. This process is crucial for studying species’ genome structures, functional gene discovery, metabolic network construction, and species evolution analysis.
With the advancements in sequencing technologies and the reduction in sequencing costs, we are now able to obtain large amounts of sequencing data in a short time. However, genome assembly is a complex process, particularly when dealing with the assembly of large and complex genomes of plants and animals, which require substantial computational resources. Therefore, efficiently analyzing and processing these data has become one of the most pressing issues in genomics and bioinformatics today.
Figure 1: DNA Sequencing Flowchart (Source: Next-Generation Sequencing (NGS) - Definition, Types (microbenotes.com))
Common Genome Assembly Algorithms#
Genome assembly algorithms involve various methods, categorized into reference-based assembly and de novo assembly. The two most common de novo assembly strategies are De Bruijn graph-based assembly and Overlap-Layout-Consensus (OLC) assembly algorithms.
De Bruijn Graph:#
A De Bruijn graph is a directed graph consisting of nodes and edges. The graph requires that adjacent nodes differ by one base. By arranging the sequencing reads in k-mer fashion, the De Bruijn graph helps to assemble longer contigs. For example, if several reads overlap, they can be easily joined into a longer contig. The real scenario is more complex, but we typically retain the backbone path and assemble it into Contig1.
Overlap-Layout-Consensus (OLC):#
The OLC method first constructs an overlap graph, then converges it into contigs, and finally selects the most likely nucleotide sequence for each contig. The overlap graph represents sequences that share several identical bases at their ends. Multiple read fragments can form an overlap graph. The algorithm seeks the shortest contig sequence such that all the reads are subsets of this sequence, often implemented using a greedy algorithm.
Figure 2: OLC (left) and DBG Algorithm Diagram (right) (Source: https://qinqianshan.com/bioinformatics/bin/olc-dbg/)
Applying Quantum Computing to Solve Genome Assembly Problems#
Problem Transformation#
High-quality genome assembly requires deep sequencing to meet the necessary depth. For a complete human genome assembly, a coverage of 30x or more is typically recommended. Using third-generation sequencing (e.g., PacBio and Oxford Nanopore) for human genome assembly, each read can span thousands to tens of thousands of bases. With 30x coverage, the required number of reads could range from several million to tens of millions. Assembling such a large number of reads for the overlap graph typically involves significant computational complexity and power requirements. Classical computing often uses methods such as overlap filtering and dynamic programming to reduce computational complexity, but assembling a high-quality genome still takes a lot of time. Here, we introduce quantum algorithms to accelerate this process.
The most critical step in the OLC algorithm is constructing the overlap graph to determine the positional relationships between different reads. This step can be transformed into a combinatorial optimization problem known as the Traveling Salesman Problem (TSP). In this case, different reads represent different city nodes, and the overlap length between reads serves as the weight between nodes. The objective is to sort all the reads based on their overlap length and try to assemble them into a single sequence with the longest overall overlap, as shown in Figure 3.
Figure 3: Sequencing Reads Assembly Transformed into Directed Graph Model
Modeling Steps#
1. Variable Definition#
In this model, we treat all reads as nodes, and the weight of the edges between the nodes is the overlap length between two reads that are connected in sequence. This forms a weighted directed graph. The goal is to find the longest overall overlap length for the reads sequence, which translates to finding the Hamiltonian cycle with the largest weight. The weighted directed graph is represented by an adjacency matrix: , where the index elements represent the overlap length of followed by . If the overlap length is below a threshold or , then . The decision variable takes values of , where 1 indicates that is in the j-th position, otherwise 0.
To maximize the overlap length, the objective function can be written as:
2. Constraints Handling#
Each read must and can only appear once in the sequence,
Each position in the sequence must and can only be occupied by one read,
The above two constraints can be written in QUBO form as follows:
3. QUBO Model Construction#
Thus, from the above constraints, we can construct a model that traverses all the points in the path (also known as the Hamiltonian cycle):
The optimization goal is to minimize ( H )
4. Solve the QUBO Model Directly with Solver in Kaiwu SDK#
import random
import numpy as np
import kaiwu as kw
np.set_printoptions(linewidth=1000)
SEED = 0
class DNAReconstruction:
"""
Build a QUBO model for DNA sequence assembly using TSP transformation.
"""
def __init__(self) -> None:
self.reads = [] # Sequence reads
self.cutpoint = [] # Cut points
self.reads_sort = None
self.answer = None
self.qubo_model = None
self.path_cost = None
self.ham_cycle = None
@staticmethod
def _align_core(read1, read2, max_mismatch, cut_off):
"""
Core alignment logic shared by align and aligncycle methods.
Returns the shift value and mismatch count if alignment is successful, otherwise returns None.
"""
l1 = len(read1)
for shift in range(0, l1 - cut_off):
mismatch = 0 # Number of mismatched bases
r2i = 0
for r1i in range(shift, l1):
if read1[r1i] != read2[r2i]:
mismatch += 1 # Increment mismatch count
if r2i < len(read2) - 1:
r2i += 1
else:
break
if mismatch > max_mismatch: # If mismatches exceed tolerance, break out
break
if mismatch <= max_mismatch: # If mismatches are within tolerance
return shift, mismatch # Return the shift value and mismatch count
return None # No valid alignment found
@staticmethod
def align(read1, read2, max_mismatch, cut_off):
"""
Overlap module, Read1 is the head and Read2 is the tail for alignment, returning the overlap length.
"""
result = DNAReconstruction._align_core(read1, read2, max_mismatch, cut_off)
if result:
shift, _ = result
return min(len(read1) - shift, len(read2))
return 0
@staticmethod
def aligncycle(read1, read2, max_mismatch, cut_off):
"""
Overlap module, Read1 is the head and Read2 is the tail for alignment, returning the initial position.
"""
result = DNAReconstruction._align_core(read1, read2, max_mismatch, cut_off)
if result:
shift, _ = result
return len(read1) - shift
return 0
def shot_gun(self, gene_ref, reads_number):
"""
Given a gene sequence Gene_ref, replicate it reads_number times,
connecting the ends, then randomly cut each loop in half
"""
self.reads = [] # Sequence reads
self.cutpoint = [] # Cut points
n = len(gene_ref)
for _ in range(0, reads_number):
# Randomly cut the n-length gene sequence into two segments,
# resulting in 2n reads
cut_1 = random.randint(0, len(gene_ref) - 1)
cut_2 = (cut_1 + round(len(gene_ref) / 2) + random.randint(-40, 40)) % n
# Randomly cut the gene sequence at two points,
# making the segments approximately equal in length with a ±10% variation
gene_cut_1 = min(cut_1, cut_2)
gene_cut_2 = max(cut_1, cut_2)
self.cutpoint.append(gene_cut_1)
self.cutpoint.append(gene_cut_2)
self.reads.append(gene_ref[gene_cut_1 : gene_cut_2 - 1]) # One segment
self.reads.append(
gene_ref[gene_cut_2 - 1 :] + gene_ref[0:gene_cut_1]
) # The other segment
def merge_seq(self, dna_sort):
"""
Consensus module, assemble DNA according to the sorting order.
Given a sequence, return the reads assembled in that order.
"""
merge = self.reads[dna_sort[0]] # Reconstruct the gene sequence
n = len(self.reads)
sum_overlap = 0 # Total overlap length
r1i = 0
r2i = 0
# Connect gene fragments in the order of the solution, starting from the 0th and going to the n-1th
while r2i < (n - 1):
r2i += 1
overlap = self.align(
self.reads[dna_sort[r1i]], self.reads[dna_sort[r2i]], 0, 0
)
overlap1 = self.align(
self.reads[dna_sort[r2i - 1]], self.reads[dna_sort[r2i]], 0, 0
)
sum_overlap = overlap1 + sum_overlap
# If overlap length is greater than R2 length, R1 completely covers R2,
# skip fusion. R1 stays, and R2 moves to the next.
if len(self.reads[dna_sort[r2i]]) > overlap:
merge = merge + self.reads[dna_sort[r2i]][overlap:]
r1i = r2i
# Then connect the current longest tail with the 0th
overlap = self.aligncycle(
self.reads[dna_sort[n - 1 - r2i + r1i]], self.reads[dna_sort[0]], 0, 0
)
if overlap != 0:
merge = merge[:-overlap]
if len(self.reads[dna_sort[0]]) > overlap:
sum_overlap = overlap + sum_overlap
else:
sum_overlap = len(self.reads[dna_sort[0]]) + sum_overlap
return [merge, sum_overlap]
def prepare_model(self, gene_ref, reads_number, constraint, max_mismatch, cut_off):
"""
Convert DNA sequencing reads into a TSP adjacency matrix,
where the edge weights are the overlaps,
and the direction of the edge is row index → column index
"""
self.shot_gun(gene_ref, reads_number)
n = len(self.reads)
tsp_adj_matrix = np.zeros((n, n))
for r1 in range(0, n):
for r2 in range(0, n):
if r1 != r2:
tsp_adj_matrix[r1][r2] = self.align(
self.reads[r1], self.reads[r2], max_mismatch, cut_off
)
# Create the QUBO variable matrix.
# The variable Reads_Sort(i,j) means that the i-th gene read is sorted in the j-th position
self.reads_sort = kw.core.ndarray((n, n), "Reads_Sort", kw.core.Binary)
w = tsp_adj_matrix
# Get the set of edges and non-edges
edges = [(u, v) for u in range(n) for v in range(n) if w[u, v] != 0]
# Read constraints: each read should belong to only one position
sequence_cons = kw.core.quicksum(
[
(1 - kw.core.quicksum([self.reads_sort[v, j] for j in range(n)])) ** 2
for v in range(n)
]
)
# Position constraints: each position should have only one read
node_cons = kw.core.quicksum(
[
(1 - kw.core.quicksum([self.reads_sort[v, j] for v in range(n)])) ** 2
for j in range(n)
]
)
# Hamiltonian cycle constraint, removing edge constraints
self.ham_cycle = sequence_cons + node_cons
# Total COST is the sum of overlap lengths;
# since the total length of DNA fragments should be minimized,
# COST should be maximized, so the negative sign is taken in the objective function
self.path_cost = -kw.core.quicksum(
[
w[u, v]
* (
kw.core.quicksum(
[
self.reads_sort[u, j] * self.reads_sort[v, j + 1]
for j in range(n - 1)
]
)
+ self.reads_sort[u, n - 1] * self.reads_sort[v, 0]
)
for u, v in edges
]
)
qubo_model = kw.core.QuboModel()
obj = constraint * self.ham_cycle + self.path_cost
qubo_model.set_objective(obj)
self.qubo_model = qubo_model
def print_answer(self):
"""
First restore the reference answer as an IS matrix,
then add the spin term to get the reference answer's solution vector Answer_vec,
and the reference answer provides other information
"""
self.answer = np.argsort(self.cutpoint) # Reference answer
n = len(self.reads) # Number of reads
mat_answer = np.zeros((n, n), dtype=int)
for i, x in enumerate(self.answer):
mat_answer[i, x] = 1
return mat_answer
def assert_documented_results():
"""Check that the documented model-building path stays valid."""
dna_reconstruction = DNAReconstruction()
gene_ref = (
"ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTA"
"CGTCCCGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACT"
"CTCTCGTCCCCTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCT"
)
dna_reconstruction.prepare_model(gene_ref, 3, 200, 0, 3)
answer = dna_reconstruction.print_answer()
assert dna_reconstruction.qubo_model is not None
assert answer.shape == (6, 6)
if __name__ == "__main__":
dna_reconstruction = DNAReconstruction()
GENE_REF = (
"ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTA"
"CGTCCCGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACT"
"CTCTCGTCCCCTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCT"
)
# Prepare the model, testing reads_number with 7, 8, 9, and 10
# Duplicate the DNA sequence into reads_number copies, connect the ends,
# and randomly cut each circle into two halves
READS_NUMBER = 3
# max_mismatch is the allowed mismatch in DNA alignment; exceeding it means the reads are not adjacent
MAX_MISMATCH = 0
# cut_off is the minimum overlap length threshold; if the overlap length between two reads
# does not reach the threshold, it is set to 0
CUT_OFF = 3
# The penalty coefficient for the Hamiltonian constraint in the final objective function
CONSTRAINT = 200
"""
Amplify the DNA sequence and randomly cut it into fragments using the shotgun method.
Then sequence to obtain reads (this does not account for sequencing errors; fragments are directly used as reads).
Store these reads as a weighted directed graph based on overlap length, and convert it into a TSP-like QUBO model.
Based on the standard assembly order of the reference gene, provide the solution vector, Hamiltonian,
and path length Hamiltonian for reference.
"""
dna_reconstruction.prepare_model(
GENE_REF, READS_NUMBER, CONSTRAINT, MAX_MISMATCH, CUT_OFF
)
solver = kw.classical.SimulatedAnnealingOptimizer(
initial_temperature=10000,
alpha=0.9,
cutoff_temperature=0.01,
iterations_per_t=200,
size_limit=100,
)
sol_dict, qubo_val = solver.solve_qubo(dna_reconstruction.qubo_model)
# Substitute the spin vector and obtain the result dictionary
ham_val = kw.core.get_val(dna_reconstruction.ham_cycle, sol_dict)
print(f"ham_cycle: {ham_val}")
# Calculate the path length using path_cost
path_val = kw.core.get_val(dna_reconstruction.path_cost, sol_dict)
print(f"path_cost: {path_val}")
Comparison of Quantum Computing and Classical Methods#
We compared the solving time of the SPQC hardware and traditional solvers (Simulated Annealing, Tabu Search) at different problem scales (reads of 7, 8, 9, and 10). The comparison shows that, for problems of the same scale, the solving time of SPQC is much shorter than that of Simulated Annealing and Tabu Search (left figure). Moreover, as the problem scale increases, the SPQC solving time becomes more stable compared to Simulated Annealing and Tabu Search (right).
Figure 4: Comparison of Solving Time of SPQC Hardware and Traditional Solvers (Simulated Annealing, Tabu Search) at Different Problem Scales (reads of 7, 8, 9, 10)
For example, with 7 reads, we can see that the SPQC hardware from the ‘TianGong Quantum Brain’ quickly reduces its Hamiltonian energy to find the optimal solution, compared to the SA algorithm.
Figure 5: Hamiltonian Evolution for SPQC (Red Line) and SA (Blue Line) with 7 Reads
Code Implementation#
import random
import numpy as np
import kaiwu as kw
class DnaReconstruction:
"""
Build a QUBO model for DNA sequence assembly using TSP transformation.
"""
def __init__(self) -> None:
self.reads = []
self.qubo_model = None
self.ham_cycle = None
self.path_cost = None
@staticmethod
def _overlap_length(
seq1: str, seq2: str, max_mismatch: int, min_overlap: int
) -> int:
"""
Return overlap length between seq1 (head) and seq2 (tail)
allowing up to max_mismatch mismatches and requiring at least
min_overlap bases.
"""
len1 = len(seq1)
len2 = len(seq2)
for shift in range(len1 - min_overlap + 1):
mismatch = 0
overlap = min(len1 - shift, len2)
for i in range(overlap):
if seq1[shift + i] != seq2[i]:
mismatch += 1
if mismatch > max_mismatch:
break
if mismatch <= max_mismatch and overlap >= min_overlap:
return overlap
return 0
@staticmethod
def _circular_overlap(
seq1: str, seq2: str, max_mismatch: int, min_overlap: int
) -> int:
"""
Return overlap length for circular assembly of seq1 -> seq2.
"""
return DnaReconstruction._overlap_length(
seq1 + seq1[:min_overlap], seq2, max_mismatch, min_overlap
)
def shotgun(self, reference: str, reads_count: int) -> None:
"""
Generate reads by circularly cutting the reference sequence into two
segments, repeats reads_count times.
"""
self.reads.clear()
seq_len = len(reference)
for _ in range(reads_count):
cut1 = random.randrange(seq_len)
cut2 = (
cut1 + seq_len // 2 + random.randint(-seq_len // 10, seq_len // 10)
) % seq_len
var_a, var_b = sorted((cut1, cut2))
self.reads.append(reference[var_a:var_b])
self.reads.append(reference[var_b:] + reference[:var_a])
def prepare_model(
self,
reference: str,
reads_count: int,
penalty: float,
max_mismatch: int,
min_overlap: int,
) -> None:
"""
Build QUBO model: nodes = reads, weights = overlaps, constraints
enforce Hamiltonian cycle (TSP).
"""
self.shotgun(reference, reads_count)
dimension = len(self.reads)
overlaps = np.zeros((dimension, dimension), dtype=int)
for i in range(dimension):
for j in range(dimension):
if i != j:
overlaps[i, j] = self._overlap_length(
self.reads[i], self.reads[j], max_mismatch, min_overlap
)
# QUBO variables: ReadsSort[i,j] == 1 if read i at position j
reads_sort = kw.core.ndarray(
(dimension, dimension), "ReadsSort", kw.core.Binary
)
# Objective: maximize overlap -> minimize negative overlap
self.path_cost = -kw.core.quicksum(
[
overlaps[i, j]
* (
kw.core.quicksum(
[
reads_sort[i, k] * reads_sort[j, k + 1]
for k in range(dimension - 1)
]
)
+ reads_sort[i, dimension - 1] * reads_sort[j, 0]
)
for i in range(dimension)
for j in range(dimension)
if overlaps[i, j] > 0
]
)
# Constraints: each read appears exactly once, each position exactly one read
row_cons = kw.core.quicksum(
[
(1 - kw.core.quicksum([reads_sort[i, k] for k in range(dimension)]))
** 2
for i in range(dimension)
]
)
col_cons = kw.core.quicksum(
[
(1 - kw.core.quicksum([reads_sort[i, k] for i in range(dimension)]))
** 2
for k in range(dimension)
]
)
# Hamiltonian cycle constraint
self.ham_cycle = row_cons + col_cons
objective = penalty * self.ham_cycle + self.path_cost
self.qubo_model = kw.core.QuboModel()
self.qubo_model.set_objective(objective)
def solve(self, **sa_params) -> tuple:
"""
Solve QUBO model with simulated annealing.
Return (solution_dict, qubo_value).
"""
solver = kw.classical.SimulatedAnnealingOptimizer(**sa_params)
return solver.solve_qubo(self.qubo_model)
def assert_documented_results():
"""Check that the documented model-building path stays valid."""
gene_seq = (
"ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACG"
"TCCCGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACTCTCTCG"
"TCCCCTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCT"
)
assembler = DnaReconstruction()
assembler.prepare_model(
reference=gene_seq,
reads_count=3,
penalty=200.0,
max_mismatch=0,
min_overlap=3,
)
assert assembler.qubo_model is not None
if __name__ == "__main__":
GENE_SEQ = (
"ATGGCTGCTAGGCTGTGCTGCCAACTGGATCCTGCGCGGGACGTCCTTTGTTTACG"
"TCCCGTCGGCGCTGAATCCTGCGGACGACCCTTCTCGGGGTCGCTTGGGACTCTCTCG"
"TCCCCTTCTCCGTCTGCCGTTCCGACCGACCACGGGGCGCACCTCTCT"
)
assembler = DnaReconstruction()
assembler.prepare_model(
reference=GENE_SEQ, reads_count=3, penalty=200.0, max_mismatch=0, min_overlap=3
)
sol, qubo_val = assembler.solve(
initial_temperature=10000,
alpha=0.9,
cutoff_temperature=0.001,
iterations_per_t=200,
size_limit=100,
)
ham_val = kw.core.get_val(assembler.ham_cycle, sol)
path_val = kw.core.get_val(assembler.path_cost, sol)
print(f"Hamiltonian constraint value: {ham_val}")
print(f"Path cost (overlap sum): {path_val}")